wiki:TestFreek

Test with an animated GIF (see gifanimations.com)

An animated GIF (example from gifanimations.com, see gifanimations.com/animation/MenuSelection/1/53).

Manual Reference Pages - bwa (1)

DOWNLOADS

DownloadsTestPage

NAME

bwa - Burrows-Wheeler Alignment Tool

CONTENTS

Freek: not working yet.

SYNOPSIS

bwa index -a bwtsw database.fasta

bwa aln database.fasta short_read.fastq > aln_sa.sai

bwa samse database.fasta aln_sa.sai short_read.fastq > aln.sam

bwa sampe database.fasta aln_sa1.sai aln_sa2.sai read1.fq read2.fq > aln.sam

bwa bwasw database.fasta long_read.fastq > aln.sam

DESCRIPTION

BWA is a fast light-weighted tool that aligns relatively short sequences (queries) to a sequence database (targe), such as the human reference genome. It implements two different algorithms, both based on Burrows-Wheeler Transform (BWT). The first algorithm is designed for short queries up to ~200bp with low error rate (<3%). It does gapped global alignment w.r.t. queries, supports paired-end reads, and is one of the fastest short read alignment algorithms to date while also visiting suboptimal hits. The second algorithm, BWA-SW, is designed for long reads with more errors. It performs heuristic Smith-Waterman-like alignment to find high-scoring local hits (and thus chimera). On low-error short queries, BWA-SW is slower and less accurate than the first algorithm, but on long queries, it is better.

For both algorithms, the database file in the FASTA format must be first indexed with the ‘index’ command, which typically takes a few hours. The first algorithm is implemented via the ‘aln’ command, which finds the suffix array (SA) coordinates of good hits of each individual read, and the ‘samse/sampe’ command, which converts SA coordinates to chromosomal coordinate and pairs reads (for ‘sampe’). The second algorithm is invoked by the ‘dbtwsw’ command. It works for single-end reads only.

Test some really long lines for the deletion event example

1818    D 54    ChrID 20        BP 9644762      9644817 BP_range 9644761 9644824 Supports 22 + 12 - 10 S1 143 S2 727.789 SUM_MS 800 NumSupSamples 2 COLO-829 15 COLO-829-BL 7
CTGCACATTGTGCAGATGTACCCTAGAACTTAAAGTGTAATAAAAAATATGTACATAAAAATCAAAATCAAAGAAAGAACATGCAGTAGCTGAAAAAAAATATCTTCTCAaaagc<44>aaaaaAAAGCATGCTCTATGTTTTAAACTATTATTGCTAGGATCACTAGGACTTAGTAAAAAGCAATGCCTTACACAGGCAACAATAAATTCTAGAAGGAC
                                                    ACATAAAAATCAAAATCAAAGAAAGAACATGCAGTAGCTGAAAAAAAATATCTTCTCA              AAAGCATGCTCTATGTT                                                                +     9644363 37       COLO-829        @EAS131_6:7:81:1291:393/2
                                                                          AAGAACATGCAGTAGCTGAAAAAAAATATCTTCTCA              AAAGCATGCTCTATGTTTTAAACTATTATTGCTAGGATC                                          +     9644365 37       COLO-829        @EAS25_5:7:61:1007:1249/1
                                                               AAAATCAAAGAAAGAACATGCAGTAGCTGAAAAAAAATATCTTCTCA              AAAGCATGCTCTATGTTTTAAACTATTA                                                     +     9644368 37       COLO-829        @EAS139_60:7:95:1693:1286/2
                                                                   TCAAAGAAAGAACATGCAGTAGCTGAAAAAAAATATCTTCTCA              AAAGCATGCTCTATGTTTTAAACTATTATTGC                                                 +     9644374 37       COLO-829        @EAS192_60:7:50:1305:190/2
                                                                       AGAAAGAACATGCAGTAGCTGAAAAAAAATATCTTCTCA              AAAGCATGCTCTATGTTTTAAACTATTATTGCTAGG                                             +     9644377 37       COLO-829        @EAS139_60:4:78:1446:1295/2

COMMANDS AND OPTIONS

With the #td and #th processors, table cells can contain any content:

  • lists
  • embedded tables
  • simple multiline content

As processors can be easily nested, so can be tables:

Example:

must be at the third level now...

Even when you don't have complex markup, this form of table cells can be convenient to write content on multiple lines.

Last modified 7 years ago Last modified on Aug 31, 2011, 3:28:32 PM

Attachments (1)

  • Wolf.gif (10.2 KB) - added by freek.de.bruijn@… 8 years ago. An animated GIF (example from gifanimations.com, see gifanimations.com/animation/MenuSelection/1/53).

Download all attachments as: .zip