Version 45 (modified by y.zhang@…, 3 years ago)

--

Getting started

Download PASSION

Installation

PASSION requires gcc >=4.3, SMALT, perl, and SAMtools to be pre-installed.

Go to PASSION directory to compile the component

cd  path_to_passion/PASSION
sh compile.sh

Go to SMALT directory, set the right binary version of smalt (according to your system)  smalt-0.4.3

cp smalt_version smalt
(example:) cp smalt_x86_64 smalt

Install Samtools  samtools-0.1.8

Set SMALT, SAMtools and PASSION directory to PATH

Details see Full Installation

Index the reference

smalt index -k 13 -s 6 refindex reference.fa
samtools faidx reference.fa

Run PASSion

For one library

passion.pl -s insert_size -r read1.fq -f read2.fq -R reference.fa -I refindex

Find differential splicing patterns in multiple samples

step1: edit a configure file. For example sample.txt

./s8_passion_output	s8
./s1_passion_output	s1
./s2_passion_output	s2

step2: run passion_diff.pl

passion_diff.pl -f sample.txt

Example: discovery of junctions at chromosome 17 (sample.txt needs to be edited)

cd  path_to_testset/testset
smalt index -k 13 -s 6 17 17.fa
samtools faidx 17.fa
passion.pl -s 200 -r read1.50.fq -f read2.50.fq -R 17.fa -I 17 -o s1_passion_output
passion.pl -s 300 -r read1.75.fq -f read2.75.fq -R 17.fa -I 17 -o s2_passion_output
passion.pl -s 500 -r read1.100.fq -f read2.100.fq -R 17.fa -I 17 -o s8_passion_output
passion_diff.pl -f sample.txt

Details about how to set the parameters, please see User Manual

Output

Junctions.bed: Detected junctions in bed format: column 7 and 8 record the breakpoint range.

track name=junctions description= "PASSION junctions" 
17	4013121	4015916	JUNC_0	1	-	4013157	4015903	255,0,0	2	36,14	0,2781
17	12920399	12921087	JUNC_1	1	-	12920412	12921055	255,0,0	2	16,34	0,654
17	41959870	41960311	JUNC_2	1	-	41959878	41960272	255,0,0	2	9,41	0,400
17	79205244	79205395	JUNC_3	1	-	79205273	79205378	255,0,0	2	32,18	0,133
17	74141605	74157944	JUNC_4	1	+	74141643	74157935	255,0,0	2	40,10	0,16329

Junctions.detail: Details about how split reads align to exon-exon boundaries

1st Summary: Due to the existance of microhomology, breakpoint ranges are also reported. For example, at the following breaking point, "AG" can be either aligned to the left or the right. In this format, we report the leftmost breakpoint and the range. The final breakpoint will be design with the assistance of splicing motifs. LL/RL: left/right hanging length on the exons. +/-: downstream/upperstream reads for support

2nd line: Reference

3rd line: Alignment

####################################################################################################
401	D 1331	ChrID chr17	BP 1678492	1679824	BP_range 1678492	1679826	Supports 5	+ 3	- 2	S1 12	S2 123.658	LL 33	RL 40	SUM_MS 283	NumSupSamples 2	+ 3	- 2
GGACCCTAAGGCTGTTTTACGCTATGGCTTGGATTCAGATCTCAGCTGCAaggtctgtag<1311>cacttgtctcAGATTGCCCAGCTGCCCTTGACCG
                                   CAGATCTCTGCTGCA                          AGATTGCCCAGCTGCCCTTGACCGGA                        	+	1675548	60	+	@ENST00000254722_747_973_34_1_Far
                 TACGCTATGGCTTGGATTCAGATCTCAGCTGCA                          AGATTGCCCAGCTGCCC                                 	-	1679932	60	+	@ENST00000254722_915_1105_55_2
                                 TTCAGATCTCAGCGGCA                          AGATTGCCCAGCTGCCCTTGACCCGAAGCATGA                 	-	1679926	60	+	@ENST00000254722_931_1099_2_2
                      TATGGCTTGGATTCAGATCTCAGCTGCA                          AGATTGCCCAGCTGCCCTTGAC                            	+	1675314	60	-	@ENST00000254722_749_969_21_2
                                        CTCAGCTGCA                          AGATTGCCCAGCTGCCCTTGACCGGAAGCATGAGTATCAT          	+	1675343	43	-	@ENST00000254722_780_987_18_2


orignal.sam: exonic reads alignment in SAM format

final.sam: exnoic reads and split reads alignment in SAM format

Junctions_mix.bed: color column shows the intersection of the junctions.

track name=junctions description="PASSion mix junctions s8:255,0,0; s1:0,255,0; s2:0,0,255; mix:255,255,255"
17	73204682	73205959	JUNC_0	1	+	73204713	73205918	0,0,255	2	33,42	0,1235
17	35804822	35818670	JUNC_1	2	+	35804869	35818626	0,0,255	2	48,45	0,13803
17	41959831	41960322	JUNC_2	2	-	41959878	41960272	255,255,255	2	48,52	0,439
17	26967654	26968934	JUNC_3	1	-	26967701	26968912	0,0,255	2	47,28	0,1252
17	29685990	29687527	JUNC_4	3	+	29686031	29687505	255,255,255	2	43,23	0,1514
17	80007651	80007826	JUNC_5	1	-	80007718	80007798	255,0,0	2	67,33	0,142
17	34901642	34910711	JUNC_6	2	+	34901665	34910661	255,255,255	2	24,51	0,9018
17	61776260	61776424	JUNC_7	1	-	61776298	61776390	0,0,255	2	38,37	0,127
17	74936571	74936842	JUNC_8	2	+	74936628	74936817	255,255,255	2	59,29	0,242
17	62020427	62021126	JUNC_9	1	-	62020456	62021109	0,255,0	2	29,21	0,678

Junctions_mix.final:"Lenth\tRef\tBP_S\tBP_E\tRange_S\tRange_E\tSupport\tSup+\tSup-\tLL\tRL\tMarker\tStart\tEnd\tLefexon_cov\tRightexon_cov\sample_count\details\n";

13755	chr17	35804869	35818625	35804869	35818626	3	3	0	17	39	GTAG	35804870	35818626	4.42666666666667	5.21538461538462	1	s1:3;
1202	chr17	73204713	73205916	73204713	73205918	2	1	1	33	24	GTAG	73204715	73205918	2.70967741935484	3.36440677966102	1	s1:2;
1092	chr17	48601143	48602236	48601143	48602238	2	0	2	39	18	GTAG	48601145	48602238	4.60526315789474	2.69021739130435	1	s1:2;
566	chr17	73567181	73567748	73567181	73567749	2	1	1	35	22	GTAG	73567181	73567748	2.35526315789474	2.57352941176471	1	s1:2;
25061	chr17	13980370	14005432	13980370	14005435	1	1	0	26	24	GTAG	13980373	14005435	2.58785249457701	1	1	s1:1;
1471	chr17	29686031	29687503	29686031	29687505	8	4	4	37	40	GTAG	29686033	29687505	5.89375	5.42089552238806	2	s1:6;s2:2;
1069	chr17	62125345	62126415	62125345	62126416	1	0	1	11	39	CTAC	62125345	62126415	3.93103448275862	1.59459459459459	1	s1:1;
183	chr17	74936628	74936812	74936628	74936817	6	3	3	38	34	GTAG	74936630	74936814	6.59376048305937	6.59376048305937	2	s1:5;s2:1;
649	chr17	62020456	62021106	62020456	62021109	1	0	1	29	21	CTAC	62020456	62021106	1.3015873015873	1	1	s2:1;

Home page