Getting started
Download PASSION
Installation
PASSION requires gcc >=4.3, SMALT, perl, and SAMtools to be pre-installed.
Go to PASSION directory to compile the component
cd path_to_passion/PASSION sh compile.sh
Go to SMALT directory, set the right binary version of smalt (according to your system) smalt-0.5.7
cp smalt_version smalt (example:) cp smalt_x86_64 smalt
Install Samtools samtools-0.1.8
Set SMALT, SAMtools and PASSION directory to PATH
Details see Full Installation
Index the reference
smalt index -k 13 -s 6 refindex reference.fa samtools faidx reference.fa
Run PASSion
For one library
passion.pl -s insert_size -r read1.fq -f read2.fq -R reference.fa -I refindex
Find differential splicing patterns in multiple samples
step1: edit a configure file. For example sample.txt
./s8_passion_output s8 ./s1_passion_output s1 ./s2_passion_output s2
step2: run passion_diff.pl
passion_diff.pl -f sample.txt
Example: discovery of junctions at chromosome 17 (sample.txt needs to be edited)
cd path_to_testset/testset smalt index -k 13 -s 6 17 17.fa samtools faidx 17.fa passion.pl -s 200 -r read1.50.fq -f read2.50.fq -R 17.fa -I 17 -o s1_passion_output passion.pl -s 300 -r read1.75.fq -f read2.75.fq -R 17.fa -I 17 -o s2_passion_output passion.pl -s 500 -r read1.100.fq -f read2.100.fq -R 17.fa -I 17 -o s8_passion_output passion_diff.pl -f sample.txt
Details about how to set the parameters, please see User Manual
Output
Junctions.bed: Detected junctions in bed format: column 7 and 8 record the breakpoint range.
Junction start = Column2+Column11[1]; Junction end = Column3-Column11[2]+1
See generic BED file format at UCSC BED
track name=junctions description= "PASSION junctions" 17 12920399 12921087 JUNC_1 1 - 12920412 12921055 255,0,0 2 16,34 0,654 17 41959870 41960311 JUNC_2 1 - 41959878 41960272 255,0,0 2 9,41 0,400 17 79205244 79205395 JUNC_3 1 - 79205273 79205378 255,0,0 2 32,18 0,133 17 74141605 74157944 JUNC_4 1 + 74141643 74157935 255,0,0 2 40,10 0,16329
Junctions.detail: Details about how split reads align to exon-exon boundaries
1st Summary: Due to the existance of microhomology, breakpoint ranges are also reported. For example, at the following breaking point, "AG" can be either aligned to the left or the right. In this format, we report the leftmost breakpoint and the range. The final breakpoint will be design with the assistance of splicing motifs. LL/RL: left/right hanging length on the exons. +/-: downstream/upperstream reads for support
2nd line: Reference
3rd line: Alignment
####################################################################################################
401 D 1331 ChrID 17 BP 1678492 1679824 BP_range 1678492 1679826 Supports 5 + 3 - 2 S1 12 S2 123.658 LL 33 RL 40 SUM_MS 283 NumSupSamples 2 + 3 - 2
GGACCCTAAGGCTGTTTTACGCTATGGCTTGGATTCAGATCTCAGCTGCAaggtctgtag<1311>cacttgtctcAGATTGCCCAGCTGCCCTTGACCG
CAGATCTCTGCTGCA AGATTGCCCAGCTGCCCTTGACCGGA + 1675548 60 + @ENST00000254722_747_973_34_1_Far
TACGCTATGGCTTGGATTCAGATCTCAGCTGCA AGATTGCCCAGCTGCCC - 1679932 60 + @ENST00000254722_915_1105_55_2
TTCAGATCTCAGCGGCA AGATTGCCCAGCTGCCCTTGACCCGAAGCATGA - 1679926 60 + @ENST00000254722_931_1099_2_2
TATGGCTTGGATTCAGATCTCAGCTGCA AGATTGCCCAGCTGCCCTTGAC + 1675314 60 - @ENST00000254722_749_969_21_2
CTCAGCTGCA AGATTGCCCAGCTGCCCTTGACCGGAAGCATGAGTATCAT + 1675343 43 - @ENST00000254722_780_987_18_2
orignal.sam: exonic reads alignment in SAM format
final.sam: exnoic reads and split reads alignment in SAM format
Junctions_mix.bed: color column shows the intersection of the junctions.
track name=junctions description="PASSion mix junctions s8:255,0,0; s1:0,255,0; s2:0,0,255; mix:255,255,255" 17 73204682 73205959 JUNC_0 1 + 73204713 73205918 0,0,255 2 33,42 0,1235 17 35804822 35818670 JUNC_1 2 + 35804869 35818626 0,0,255 2 48,45 0,13803 17 41959831 41960322 JUNC_2 2 - 41959878 41960272 255,255,255 2 48,52 0,439 17 26967654 26968934 JUNC_3 1 - 26967701 26968912 0,0,255 2 47,28 0,1252 17 29685990 29687527 JUNC_4 3 + 29686031 29687505 255,255,255 2 43,23 0,1514 17 80007651 80007826 JUNC_5 1 - 80007718 80007798 255,0,0 2 67,33 0,142 17 34901642 34910711 JUNC_6 2 + 34901665 34910661 255,255,255 2 24,51 0,9018 17 61776260 61776424 JUNC_7 1 - 61776298 61776390 0,0,255 2 38,37 0,127 17 74936571 74936842 JUNC_8 2 + 74936628 74936817 255,255,255 2 59,29 0,242 17 62020427 62021126 JUNC_9 1 - 62020456 62021109 0,255,0 2 29,21 0,678
Junctions_mix.final:"Lenth \t Ref \t BP_S \t BP_E \t Range_S \t Range_E \t Support \t Sup+ \t Sup- \t LL \t RL \t Marker \t Start \t End \t Lefexon_cov \t Rightexon_cov\sample_count\details\n";
13755 17 35804869 35818625 35804869 35818626 3 3 0 17 39 GTAG 35804870 35818626 4.42666666666667 5.21538461538462 1 s1:3; 1202 17 73204713 73205916 73204713 73205918 2 1 1 33 24 GTAG 73204715 73205918 2.70967741935484 3.36440677966102 1 s1:2; 1092 17 48601143 48602236 48601143 48602238 2 0 2 39 18 GTAG 48601145 48602238 4.60526315789474 2.69021739130435 1 s1:2; 566 17 73567181 73567748 73567181 73567749 2 1 1 35 22 GTAG 73567181 73567748 2.35526315789474 2.57352941176471 1 s1:2; 25061 17 13980370 14005432 13980370 14005435 1 1 0 26 24 GTAG 13980373 14005435 2.58785249457701 1 1 s1:1; 1471 17 29686031 29687503 29686031 29687505 8 4 4 37 40 GTAG 29686033 29687505 5.89375 5.42089552238806 2 s1:6;s2:2; 1069 17 62125345 62126415 62125345 62126416 1 0 1 11 39 CTAC 62125345 62126415 3.93103448275862 1.59459459459459 1 s1:1; 183 17 74936628 74936812 74936628 74936817 6 3 3 38 34 GTAG 74936630 74936814 6.59376048305937 6.59376048305937 2 s1:5;s2:1; 649 17 62020456 62021106 62020456 62021109 1 0 1 29 21 CTAC 62020456 62021106 1.3015873015873 1 1 s2:1;
